newsletter    11 / 2018
		cell concepts gmbh
	Baculovirus Transfer Vector Plasmid Compatibility	mundenhofer weg 28   79224 umkirch
		fon +49 7665 980410
		fax +49 7665 980421
		info@cellconcepts.de
		www.cellconcepts.de
		freiburg hrb 4366
	A frequent customer query concerns baculovirus transfer vector plasmid compatibility with either flashBAC or other systems for making recombinant viruses.  Obviously, if you are buying flashBAC and our pOET range of transfer vectors you won’t have a problem.  However, given that baculovirus expression vectors have been around since 1983 and many labs have produced variations around a theme, it is not surprising that confusion can arise. Most baculovirus expression vectors are made using either homologous recombination in insect cells or via transposition insertion in bacteria.  Therefore, your major decision is which of these systems applies.  There is a limited range of plasmid transfer vector used for the latter system but many more for homologous recombination in insect cells.  Plasmid names can be very confusing as many are based on the name(s) of the original scientist(s) who made them and follow no particular convention. To help you out we have published a list of transfer vectors and their compatibility on the OET website.  Despite this resource, every so often someone asks us about a vector that isn’t on the list.  We are very happy to decipher the compatibility of your plasmid and provide a speedy response.  However, outside of normal working hours the inevitable delay may frustrate. Therefore, providing you are familiar with sequence comparison programmes such as BLAST and have the DNA sequence of your plasmid, you can use the following information to match it with other transfer vectors.  To explain this we use the pOET1 transfer vector. Below, we present a simple diagram of the regions upstream and downstream of the polyhedrin gene promoter.
	If you match both these two sequences with your own transfer vector you can quickly see if it is compatible for recombinant baculovirus generation in insect cells and in particular, if it will work with flashBACTM DNA.
	Here is the sequence of the region 1-1300
	aggccgtgacgttaaaactattaagccatccaatcgaccgttagtcgaatcaggaccgctggtgcgagaagccgcgaagt atggcgaatgcatcgtataacgtgtggagtccgctcattagagcgtcatgtttagacaagaaagctacatatttaattga tcccgatgattttattgataaattgaccctaactccatacacggtattctacaatggcggggttttggtcaaaatttccg gactgcgattgtacatgctgttaacggctccgcccactattaatgaaattaaaaattccaattttaaaaaacgcagcaag agaaacatttgtatgaaagaatgcgtagaaggaaagaaaaatgtcgtggacatgctgaacaacaagattaatatgcctcc gtgtataaaaaaaatattgaacgatttgaaagaaaacaatgtaccgcgcggcggtatgtacaggaagaggtttatactaa actgttacattgcaaacgtggtttcgtgtgccaagtgtgaaaaccgatgtttaatcaaggctctgacgcatttctacaac cacgactccaagtgtgtgggtgaagtcatgcatcttttaatcaaatcccaagatgtgtataaaccaccaaactgccaaaa aatgaaaactgtggacaagctctgtccgtttgctggcaactgcaagggtctcaatcctatttgtaattattgaataataa aacaattataaatgctaaatttgttttttattaacgatacaaaccaaacgcaacaagaacatttgtagtattatctataa ttgaaaacgcgtagttataatcgctgaggtaatatttaaaatcattttcaaatgattcacagttaatttgcgacaatata attttattttcacataaactagacgccttgtcgtcttcttcttcgtattccttctctttttcatttttctcctcataaaa attaacatagttattatcgtatccatatatgtatctatcgtatagagtaaattttttgttgtcataaatatatatgtctt ttttaatggggtgtatagtaccgctgcgcatagtttttctgtaatttacaacagtgctattttctggtagttcttcggag tgtgttgctttaattattaaatttatataatcaatgaatttgggatcgtcggttttgtacaatatgttgccggcatagta cgcagcttcttctagttcaattacaccattttttagcagcaccggattaacataactttccaaaatgttgtacgaaccgt taaacaaaaacagttcacctcccttttctatactattgtctgcgagcagttgtttgttgttaaaaataacagccat
	Here is the sequence 1628-2160
	attaagcgctagattctgtgcgttgttgatttacagacaattgttgtacgtattttaataattcattaaatttataatcttta gggtggtatgttagagcgaaaatcaaatgattttcagcgtctttatatctgaatttaaatattaaatcctcaatagattt gtaaaataggtttcgattagtttcaaacaagggttgtttttccgaaccgatggctggactatctaatggattttcgctca acgccacaaaacttgccaaatcttgtagcagcaatctagctttgtcgatattcgtttgtgttttgttttgtaataaaggt tcgacgtcgttcaaaatattatgcgcttttgtatttctttcatcactgtcgttagtgtacaattgactcgacgtaaacac gttaaataacgcttggacatatttaacatcgggcgtgttagctttattaggccgattatcgtcgtcgtcccaaccctcgt cgttagaagttgcttccgaagacgattttgccatagccacacgacgccta
	Should you still remain unsure about the suitability of your transfer vector please contact us at info@cellconcepts.de and we will be able to provide further information.
	You may place your order either by e-m: info@cellconcepts.de  fon: +497665 980410  or  fax: +497665 980421
	Sincerely yours
	CELL CONCEPTS GmbH
	Copyright © CELL CONCEPTS GmbH 1992 - 2018.
	All rights reserved. Any unauthorized use, reproduction or transfer of this message or its contents, is strictly prohibited	13.11.2018 / jk